Noble Research Institute, LLC   Noble Research Institute | VIGS Database  
      VIGS Phenomics and Functional Genomics Database  
Details




NbTI03F02

Phenotype Description
Mottled top leaves, pale leaves
Annotation
Solyc08g015690.2.1;genomic_reference:SL2.50ch08 gene_region:5133715-5137445 transcript_region:SL2.50ch08:5133715..5137445- functional_description:"Late-embryogenesis abundant protein 2 (AHRD V1 **-- C6T750_SOYBN); contains Interpro domain(s) IPR013990 Water Stress and Hypersensitive response "
ref|XP_009778727.1|;PREDICTED: uncharacterized protein LOC104228038 [Nicotiana sylvestris]
NbS00007894g0001.1;protein AED:0.25 eAED:0.25 QI:75|0|0.5|1|0|0.5|2|0|320; (*GB) gi|153793260|gb|ABS50432.1| (e_value=0.0) chilling-responsive protein [Nicotiana tabacum];; (*SWP) sp|P46518|LEA14_GOSHI (e_value=2e-19) Late embryogenesis abundant protein Lea14-A OS=Gossypium hirsutum GN=LEA14-A PE=2 SV=1;; (*TAIR) AT2G44060.2 (e_value=8e-158) | Symbols: | Late embryogenesis abundant protein, group 2 | chr2:18226922-18227988 FORWARD LENGTH=325;; (*ITAG) Solyc08g015690.2.1 (e_value=0.0) genomic_reference:SL2.40ch08 gene_region:5133715-5137445 transcript_region:SL2.40ch08:5133715..5137445- functional_description:"Late-embryogenesis abundant protein 2 (AHRD V1 **-- C6T750_SOYBN); contains Interpro domain(s) IPR013990 Water Stress and Hypersensitive response ";
AT2G44060.2;| Symbols: | Late embryogenesis abundant protein, group 2 | chr2:18226922-18227988 FORWARD LENGTH=325
GO ID (Nr annotation)
GO:0005794 GO:0005829 GO:0005886 GO:0009506 GO:0009269 GO:0009735
GO ID (Arabidopsis annotation)
GO ID (Tomato annotation)
GO:0005615 GO:0030141 GO:0043204 GO:0048237 GO:0004175 GO:0005159 GO:0001701 GO:0001822 GO:0002003 GO:0002016 GO:0032496 GO:0035690 GO:0035902 GO:0048468 GO:0050435 GO:0050794 GO:0051591 GO:0070305
GO ID (Niben annotation)
Sequence
>NbTI03F02
CACCCAAACCCCGTTCCGATTCCTCTCATTGACATAAACTATTTAATTGATAGTGATGGAAGGAAACTGGTTTCTGGATTAATCCCCGATTCTGGAACAA
TCCATGCGCATGGTTCTGAGACCGTCAAAATACCACTTCATCTGGTTTATGATGACAT
More analysis about the clones: Nicotiana benthamiana resources at Boys Thomson Institute
To find off target genes: siRNA scan
To predict efficiency of siRNA: pssRNAit

2-1:3E1-3H12[7-19-12]//3F2..JPG