NbTI09F04
Phenotype Description |
---|
Plants were similar to vector control plants |
Annotation |
---|
Solyc09g014520.2.1;genomic_reference:SL2.50ch09 gene_region:6145784-6147813 transcript_region:SL2.50ch09:6145784..6147813- functional_description:"Chlorophyll a-b binding protein 6A, chloroplastic (AHRD V1 **** CB11_SOLLC); contains Interpro domain(s) IPR001344 Chlorophyll A-B binding protein " |
NbS00017935g0003.1;protein AED:0.00 eAED:0.00 QI:240|1|0.5|1|1|1|2|0|284; (*SWP) sp|Q9XF88|CB4B_ARATH (e_value=4e-162) Chlorophyll a-b binding protein CP29.2, chloroplastic OS=Arabidopsis thaliana GN=LHCB4.2 PE=1 SV=1;; (*TAIR) AT3G08940.2 (e_value=3e-163) | Symbols: LHCB4.2 | light harvesting complex photosystem II | chr3:2717717-2718665 FORWARD LENGTH=287;; (*ITAG) Solyc09g014520.2.1 (e_value=0.0) genomic_reference:SL2.40ch09 gene_region:6145784-6147813 transcript_region:SL2.40ch09:6145784..6147813- functional_description:"Chlorophyll a-b binding protein 6A, chloroplastic (AHRD V1 **** CB11_SOLLC); contains Interpro domain(s) IPR001344 Chlorophyll A-B binding protein "; |
GO ID (Tomato annotation) |
---|
|
GO ID (Niben annotation) |
---|
|
Sequence |
>NbTI09F04 GGATCTAGTTAGCTCACATTAGCGGCAATGGCTACCGCAGCTGCCACATCCTCATTCATCGGAACACGGATGCCGGAAATTCACTCCGGTGCCGGTAGAG TCCAAGCCCGATTCGGATTTGG
|
More analysis about the clones:
Nicotiana benthamiana resources at Boys Thomson InstituteTo find off target genes:
siRNA scanTo predict efficiency of siRNA:
pssRNAit
1-1:9E1-9H12[10-31-12]//9F4.JPG |